AVISO IMPORTANTE
| "As informações fornecidas são baseadas em artigos científicos publicados. Os resumos das doenças são criados por especialistas e submetidos a um processo de avaliação científica. Estes textos gerais podem não se aplicar a casos específicos, devido à grande variabilidade de expressão da doença. Algumas das informações podem parecer chocantes. É fundamental verificar se a informação fornecida é relevante ou não para um caso em concreto. "A informação no Blog Estudandoraras é atualizada regularmente. Pode acontecer que novas descobertas feitas entre atualizações não apareçam ainda no resumo da doença. A data da última atualização é sempre indicada. Os profissionais são sempre incentivados a consultar as publicações mais recentes antes de tomarem alguma decisão baseada na informação fornecida. "O Blog estudandoraras não pode ser responsabilizada pelo uso nocivo, incompleto ou errado da informação encontrada na base de dados da Orphanet. O blog estudandoraras tem como objetivo disponibilizar informação a profissionais de cuidados de saúde, doentes e seus familiares, de forma a contribuir para o melhoramento do diagnóstico, cuidados e tratamento de doenças. A informação no blog Estudandoraras não está destinada a substituir os cuidados de saúde prestados por profissionais. |
sexta-feira, 14 de maio de 2010
Displasia spondyloepimetaphyseal, tipo Strudwick
Displasia spondyloepimetaphyseal, tipo Strudwick
Spondyloepimetaphyseal dysplasia, Strudwick type is an inherited disorder of bone growth that results in short stature (dwarfism), skeletal abnormalities, and problems with vision. displasia Spondyloepimetaphyseal, tipo Strudwick é um distúrbio hereditário do crescimento ósseo que resulta em baixa estatura, nanismo (), anormalidades esqueléticas e problemas com a visão. This condition affects the bones of the spine (spondylo-) and two regions (epiphyses and metaphyses) near the ends of long bones in the arms and legs. Essa condição afeta os ossos da coluna (spondylo) e duas regiões (epífises e metáfises) próximo às extremidades dos ossos longos dos braços e pernas. The Strudwick type was named after the first reported patient with the disorder. O tipo Strudwick foi nomeado após o primeiro paciente relatado com o transtorno.
People with this condition have short stature from birth, with a very short trunk and shortened limbs. Pessoas com essa condição têm baixa estatura de nascimento, com um tronco muito curto e encurtamento dos membros. Their hands and feet, however, are usually average-sized. Suas mãos e pés, no entanto, são geralmente de tamanho médio. Affected individuals may have an abnormally curved lower back (lordosis) or a spine that curves to the side (scoliosis). Os indivíduos afetados podem ter de volta uma curvatura anormal menor (lordose) ou uma coluna que se curva para o lado (escoliose). This abnormal spinal curvature may be severe and can cause problems with breathing. Esta curvatura anormal da coluna vertebral podem ser graves e podem causar problemas com a respiração. Instability of the spinal bones (vertebrae) in the neck may increase the risk of spinal cord damage. Instabilidade dos ossos da coluna vertebral (vértebras), no pescoço pode aumentar o risco de danos na medula espinhal. Other skeletal features include flattened vertebrae (platyspondyly), severe protrusion of the breastbone (pectus carinatum), an abnormality of the hip joint that causes the upper leg bones to turn inward (coxa vara), and an inward- and downward-turning foot (a clubfoot). Outras características incluem achatamento das vértebras do esqueleto (platyspondyly), protrusão grave do esterno (pectus carinatum), uma anormalidade da articulação do quadril que faz com que os ossos da coxa para voltar para dentro (coxa vara), e um interior e para baixo, girando o pé ( um pé torto). Arthritis may develop early in life. Artrite pode desenvolver no início da vida.
People with spondyloepimetaphyseal dysplasia, Strudwick type have mild changes in their facial features. As pessoas com displasia spondyloepimetaphyseal, tipo Strudwick tem ligeiras alterações em suas características faciais. Some infants are born with an opening in the roof of the mouth (a cleft palate) and their cheekbones may appear flattened. Algumas crianças nascem com uma abertura no teto da boca (palato) e suas bochechas podem aparecer achatado. Eye problems that can impair vision are common, such as severe nearsightedness (high myopia) and tearing of the lining of the eye (retinal detachment). problemas oculares que podem comprometer a visão são comuns, como miopia severa (alta miopia) e rasgo do forro do olho (descolamento de retina).
How common is spondyloepimetaphyseal dysplasia, Strudwick type? Quão comum é a displasia spondyloepimetaphyseal, tipo Strudwick?
This condition is rare; only a few affected individuals have been reported worldwide. Essa condição é rara, mas apenas alguns indivíduos afetados têm sido relatados em todo o mundo.
What genes are related to spondyloepimetaphyseal dysplasia, Strudwick type? Que genes estão relacionados a spondyloepimetaphyseal displasia, tipo Strudwick?
Spondyloepimetaphyseal dysplasia, Strudwick type is one of a spectrum of skeletal disorders caused by mutations in the COL2A1 gene. displasia Spondyloepimetaphyseal, tipo Strudwick faz parte de um espectro de alterações esqueléticas causadas por mutações no COL2A1 gene. This gene provides instructions for making a protein that forms type II collagen. Este gene fornece instruções para fabricar uma proteína que forma o colágeno tipo II. This type of collagen is found mostly in the clear gel that fills the eyeball (the vitreous) and cartilage. Este tipo de colágeno é encontrada principalmente no gel transparente que preenche o globo ocular (o humor vítreo) e cartilagem. Cartilage is a tough, flexible tissue that makes up much of the skeleton during early development. A cartilagem é um tecido resistente, flexível, que compõe a maior parte do esqueleto durante o desenvolvimento precoce. Most cartilage is later converted to bone, except for the cartilage that continues to cover and protect the ends of bones and is present in the nose and external ears. A maior parte da cartilagem é mais tarde se converteu ao osso, com exceção da cartilagem, que continua a cobrir e proteger as extremidades dos ossos e está presente no nariz e as orelhas externas. Type II collagen is essential for the normal development of bones and other connective tissues that form the body's supportive framework. colágeno tipo II é essencial para o desenvolvimento normal dos ossos e outros tecidos conectivos que formam quadro de apoio do corpo.
Most mutations in the COL2A1 gene that cause spondyloepimetaphyseal dysplasia, Strudwick type interfere with the assembly of type II collagen molecules. A maioria das mutações no gene COL2A1 que causam a displasia spondyloepimetaphyseal, tipo Strudwick interferir com a montagem das moléculas de colágeno tipo II. Abnormal collagen prevents bones and other connective tissues from developing properly, which leads to the signs and symptoms of spondyloepimetaphyseal dysplasia, Strudwick type. anormal de colágeno previne ossos e outros tecidos conectivos de desenvolver de forma adequada, o que leva a sintomas e sinais de displasia spondyloepimetaphyseal, tipo Strudwick.
Read more about the COL2A1 gene. Leia mais sobre o COL2A1 gene.
How do people inherit spondyloepimetaphyseal dysplasia, Strudwick type? Como as pessoas herdam a displasia spondyloepimetaphyseal, tipo Strudwick?
This condition is inherited in an autosomal dominant pattern, which means one copy of the altered gene in each cell is sufficient to cause the disorder. Esta condição é herdada em um padrão autossômico dominante, o que significa uma cópia do gene alterado em cada célula é suficiente para causar o transtorno.
Where can I find information about diagnosis, management, or treatment of spondyloepimetaphyseal dysplasia, Strudwick type? Onde posso encontrar informações sobre diagnóstico, tratamento ou o tratamento da displasia spondyloepimetaphyseal, tipo Strudwick?
These resources address the diagnosis or management of spondyloepimetaphyseal dysplasia, Strudwick type, and may include treatment providers. Esses recursos o diagnóstico de displasia ou de gestão de spondyloepimetaphyseal, tipo Strudwick, e podem incluir os provedores de tratamento.
Gene Tests: Spondyloepimetaphyseal Dysplasia, Strudwick Type Testes Gene: Displasia Spondyloepimetaphyseal, Tipo Strudwick
MedlinePlus Encyclopedia: Clubfoot Enciclopédia de MedlinePlus: Clubfoot
MedlinePlus Encyclopedia: Retinal Detachment Enciclopédia de MedlinePlus: Descolamento da retina
MedlinePlus Encyclopedia: Scoliosis Enciclopédia de MedlinePlus: escoliose
You might also find information on the diagnosis or management of spondyloepimetaphyseal dysplasia, Strudwick type, in Educational resources and Patient support . Você também pode encontrar informações sobre o diagnóstico ou a gestão de displasia spondyloepimetaphyseal, tipo Strudwick, em recursos educacionais e de apoio aos doentes .
To locate a healthcare provider, see How can I find a genetics professional in my area? in the Handbook. Para localizar um profissional de saúde, consulte Como posso encontrar um profissional da genética na minha área? no Handbook.
Where can I find additional information about spondyloepimetaphyseal dysplasia, Strudwick type? Onde posso encontrar informações adicionais sobre a displasia spondyloepimetaphyseal, tipo Strudwick?
You may find the following resources about spondyloepimetaphyseal dysplasia, Strudwick type, helpful. Você pode encontrar os seguintes recursos sobre displasia spondyloepimetaphyseal, tipo Strudwick, útil. These materials are written for the general public. Estes materiais são escritos para o público em geral.
MedlinePlus - Health information (5 links) MedlinePlus - Informação da Saúde (5 links)
Additional NIH Resources - National Institutes of Health Recursos adicionais do NIH - National Institutes of Health
National Institute of Arthritis and Musculoskeletal and Skin Diseases National Institute of Arthritis and Musculoskeletal e Doenças da Pele
Educational resources - Information pages (3 links) Recursos educacionais - páginas da Informação (3 ligações)
Patient support - For patients and families (7 links) Paciente de apoio - para pacientes e familiares (7 links)
You may also be interested in these resources, which are designed for healthcare professionals and researchers. Você também pode estar interessado nestes recursos, que são projetados para profissionais de saúde e pesquisadores.
Gene Tests Gene Testes - DNA tests ordered by healthcare professionals - Testes de DNA ordenados por profissionais de saúde
PubMed PubMed - Recent literature - A literatura recente
Online Books - Medical and science texts textos Online Livros - Medicina e Ciência
Scriver's Online Metabolic and Molecular Bases of Inherited Disease (OMMBID): Disorders of Collagen Biosynthesis and Structure Online Scriver e Molecular Bases metabólicas da doença herdada (OMMBID): Distúrbios da síntese de colágeno e Estrutura
OMIM OMIM - Genetic disorder catalog - Catálogo de desordem genética
What other names do people use for spondyloepimetaphyseal dysplasia, Strudwick type? Que outros nomes que as pessoas usam para displasia spondyloepimetaphyseal, tipo Strudwick?
Dappled metaphysis syndrome síndrome metáfise Dappled
SED Strudwick SED Strudwick
SEMD, Strudwick type SEMD, tipo Strudwick
SMED, Strudwick type SMED, tipo Strudwick
SMED, type I SMED, do tipo I
Spondylometaepiphyseal dysplasia congenita, Strudwick type Spondylometaepiphyseal displasia congênita, tipo Strudwick
Spondylometaphyseal dysplasia (SMD) Spondylometaphyseal displasia (SMD)
Strudwick syndrome síndrome Strudwick
See How are genetic conditions and genes named? in the Handbook. Veja como são as condições genéticas e genes chamado? no Handbook.
What if I still have specific questions about spondyloepimetaphyseal dysplasia, Strudwick type? E se eu ainda tiver perguntas específicas sobre a displasia spondyloepimetaphyseal, tipo Strudwick?
Ask the Genetic and Rare Diseases Information Center Pergunte ao Genéticos e Centro de Informações sobre Doenças Raras . .
Submit your question to Ask the Geneticist Envie sua pergunta para Pergunte ao geneticista . .
Where can I find general information about genetic conditions? Onde posso encontrar informações gerais sobre doenças genéticas?
The Handbook provides basic information about genetics in clear language. O Manual fornece informações básicas sobre genética, em linguagem clara.
What does it mean if a disorder seems to run in my family? O que significa que um distúrbio parece estar a correr em minha família?
What are the different ways in which a genetic condition can be inherited? Quais são as diferentes formas em que uma condição genética pode ser herdada?
If a genetic disorder runs in my family, what are the chances that my children will have the condition? Se uma desordem genética funciona em minha família, quais são as chances de que meus filhos terão a condição?
Why are some genetic conditions more common in particular ethnic groups? Por que algumas condições genéticas mais comuns em determinados grupos étnicos?
These links provide additional genetics resources that may be useful. Estes links fornecer recursos adicionais que a genética pode ser útil.
Genetics and health Genética e saúde
Resources for Patients and Families Recursos para Pacientes e Famílias
Resources for Health Professionals Recursos para Profissionais de Saúde
What glossary definitions help with understanding spondyloepimetaphyseal dysplasia, Strudwick type? definições que ajudam a compreender glossário displasia spondyloepimetaphyseal, tipo Strudwick?
arthritis ; autosomal ; autosomal dominant ; cartilage ; cell ; cleft palate ; clubfoot ; collagen ; connective tissue ; coxa vara ; dwarfism ; dysplasia ; end of long bone ; epiphysis ; gene ; joint ; lordosis ; metaphysis ; molecule ; mutation ; myopia ; nearsightedness ; palate ; protein ; scoliosis ; short stature ; sign ; spectrum ; stature ; symptom ; syndrome ; tissue ; vertebra artrite ; autosomal ; autossômica dominante ; cartilagem ; célula , fenda palatina , pé torto , colágeno , tecido conjuntivo , coxa vara , nanismo , displasia ; final dos ossos longos ; epífise ; gene ; comum ; lordose ; metáfise ; molécula ; mutação ; miopia , miopia ; palato ; proteína ; escoliose , baixa estatura ; sinal ; espectro ; estatura ; sintoma , síndrome , tecido ; vértebra
You may find definitions for these and many other terms in the Genetics Home Reference Glossary . Você pode encontrar definições para esses e muitos outros termos da Home Genética Referência Glossário .
See also Understanding Medical Terminology . Veja também Entendendo Medical Terminology .
SINDORME DE AICARDI
Síndrome de Aicardi é uma genética rara síndrome de malformação caracterizada pela ausência parcial ou total de uma estrutura-chave do cérebro chamada de corpo caloso , a presença de anomalias da retina, e as apreensões na forma de espasmos infantis . Aicardi syndrome is theorized to be caused by a defect on the X chromosome as it has thus far only been observed in girls or in boys with Klinefelter's syndrome . Síndrome de Aicardi é teoricamente ser causado por um defeito no cromossoma X , uma vez que até agora só foi observado em meninas ou meninos com a síndrome de Klinefelter . Confirmation of this theory awaits the discovery of the gene which causes Aicardi syndrome. A confirmação desta teoria aguarda a descoberta do gene que causa a síndrome de Aicardi. Symptoms typically appear before a baby reaches about 5 months of age. [ citation needed ] Os sintomas geralmente aparecem antes de um bebê atinge cerca de 5 meses de idade. [ carece de fontes? ]
Contents Conteúdo [hide]
1 History Uma História
2 Epidemiology 2 Epidemiologia
3 Genetics 3 Genética
4 Features 4 Recursos
5 Diagnosis 5 Diagnóstico
6 Treatment 6 Tratamento
7 Prognosis 7 Prognóstico
8 External links 8 Ligações externas
8.1 Further Reading 8,1 Leitura
8.2 Support Organizations Organizações de apoio 8,2
8.3 Current Research 8,3 Investigação atual
9 References 9 Referências
[ edit ] History [ editar ] História
This disorder was first recognized as a distinct syndrome in 1965 by Jean Aicardi , a French neurologist. Esta doença foi reconhecida pela primeira vez como uma síndrome distinta em 1965 por Jean Aicardi , um neurologista francês. A review article by Dr. Aicardi (Aicardi J, Aicardi syndrome: old and new findings, Int Pediatr. 1998;14(1):5-8) describes the syndrome. Um artigo de revisão pelo Dr. Aicardi (J Aicardi, síndrome de Aicardi: velhas e novas descobertas, Int Pediatr. 1998; 14 (1) :5-8), descreve a síndrome. Aicardi syndrome should not be confused with Aicardi-Goutières syndrome , a distinct disorder. [ citation needed ] Síndrome de Aicardi não deve ser confundida com a síndrome de Aicardi-Goutieres , uma desordem distinta. [ carece de fontes? ]
[ edit ] Epidemiology [ editar ] Epidemiologia
Worldwide prevalence of Aicardi Syndrome is estimated at several thousand, with approximately 900 cases reported in the United States [ 1 ] . Prevalência mundial da síndrome de Aicardi é estimado em vários milhares, com aproximadamente 900 casos relatados nos Estados Unidos [1] .
[ edit ] Genetics [ editar ] Genética
Almost all reported cases of Aicardi syndrome have been in females. Quase todos os casos notificados da síndrome de Aicardi foram do sexo feminino. The few males that have been identified with Aicardi syndrome have proved to have 47 chromosomes including an XXY sex chromosome complement, a condition called Klinefelter syndrome . [ citation needed ] Os poucos homens que foram identificados com a síndrome de Aicardi provaram ter 47 cromossomos, incluindo um XXY cromossomos sexuais complementar, uma condição chamada de Síndrome de Klinefelter . [ carece de fontes? ]
Aicardi syndrome appears to be lethal in normal males who have only one X chromosome (and a Y chromosome ). Síndrome de Aicardi parece ser letal em homens normais que têm apenas um cromossomo X (e um cromossomo Y ). In other words, Aicardi syndrome appears to be inherited in an X-linked dominant pattern due to a mutant gene on the X chromosome that is lethal in XY males. [ citation needed ] Em outras palavras, a síndrome de Aicardi parece ser herdado em um X-lig dominante padrão devido a um gene mutante no cromossomo X que é letal nos machos XY. [ carece de fontes? ]
All cases of Aicardi syndrome are thought to be due to new mutations . Todos os casos de síndrome de Aicardi são provavelmente devido a novas mutações . No person with Aicardi syndrome is known to have transmitted the X-linked gene responsible for the syndrome to the next generation. Nenhuma pessoa com síndrome de Aicardi é conhecido por ter transmitido o gene ligado ao X responsável pela síndrome de próxima geração.
[ edit ] Features [ editar ] Recursos
Children are most commonly identified with Aicardi syndrome before the age of five months. As crianças são mais comumente identificada com a síndrome de Aicardi antes da idade de cinco meses. A significant number of girls are products of normal births and seem to be developing normally until around the age of three months, when they begin to have infantile spasms . Um número significativo de meninas são produtos de partos normais e parecem estar a desenvolver normalmente até cerca de três meses de idade, quando eles começam a ter espasmos infantis . The onset of infantile spasms at this age is due to closure of the final neural synapses in the brain, a stage of normal brain development . [ citation needed ] O aparecimento de espasmos infantis nessa faixa etária se deve ao encerramento das sinapses neuronais no cérebro final, uma fase normal do desenvolvimento do cérebro . [ carece de fontes? ]
[ edit ] Diagnosis [ editar ] Diagnóstico
Aicardi syndrome is typically characterized by the following triad of features - however, one of the "classic" features being missing does not preclude a diagnosis of Aicardi Syndrome, if other supporting features are present [ 2 ] . Síndrome de Aicardi é normalmente caracterizada pela seguinte tríade de recursos - no entanto, um dos "clássicos" de recursos que estão sendo ausente não exclui o diagnóstico de Síndrome de Aicardi, se outros elementos de apoio estão presentes [2] .
Partial or complete absence of the corpus callosum in the brain ( agenesis of the corpus callosum ); ausência parcial ou total do corpo caloso no cérebro ( agenesia do corpo caloso );
Eye abnormalities known as " lacunae " of the retina that are quite specific to this disorder; and Anormalidades do olho conhecido como " lacunas "da retina que são bastante específicos para esta desordem, e
The development in infancy of seizures that are called infantile spasms . O desenvolvimento na primeira infância de apreensões que são chamados de espasmos infantis .
Other types of defects of the brain such as microcephaly , porencephalic cysts and enlarged cerebral ventricles due to hydrocephalus are also common in Aicardi syndrome. Outros tipos de defeitos do cérebro, tais como microcefalia , cistos porencefálico e ampliado ventrículos cerebrais devido a hidrocefalia também são comuns na síndrome de Aicardi.
[ edit ] Treatment [ editar ] Tratamento
Treatment of Aicardi syndrome primarily involves management of seizures and early/continuing intervention programs for developmental delays. Tratamento da síndrome de Aicardi envolve principalmente a gestão de crises convulsivas e cedo / programas de intervenção permanente em caso de atraso de desenvolvimento.
Additional complications sometimes seen with Aicardi syndrome include porencephalic cysts and hydrocephalus , and gastro-intestinal problems. complicações adicionais por vezes visto com síndrome de Aicardi incluem cistos porencefálico e hidrocefalia e problemas gastro-intestinais. Treatment for prencephalic cysts and/or hydrocephalus is often via a shunt or endoscopic fenestration of the cysts, though some require no treatment. Tratamento de cistos prencephalic e / ou hidrocefalia é frequentemente através de um shunt ou endoscópica fenestração dos cistos, embora alguns não requerem tratamento. Placement of a feeding tube , fundoplication, and surgeries to correct hernias or other gastrointestinal structural problems are sometimes used to treat gastro-intestinal issues. Colocação de um tubo de alimentação , fundoplicatura, e as cirurgias para corrigir hérnias ou outros problemas gastrointestinais estruturais são muitas vezes utilizados para tratar problemas gastro-intestinais.
[ edit ] Prognosis [ editar ] Prognóstico
The prognosis varies widely from case to case, depending on the severity of the symptoms. O prognóstico varia muito de caso para caso, dependendo da gravidade dos sintomas. However, almost all people reported with Aicardi syndrome to date have experienced developmental delay of a significant degree, typically resulting in moderate to profound mental retardation . No entanto, quase todas as pessoas com síndrome de Aicardi relatado à data tiveram atraso no desenvolvimento de um grau significativo, geralmente resultando em moderado a profundo retardo mental . The age range of the individuals reported with Aicardi syndrome is from birth to the mid 40s. A faixa etária dos indivíduos relatados com síndrome de Aicardi é desde o nascimento até meados dos anos 40. There is no cure for this syndrome. Não há cura para esta síndrome.
MIOPATIA MIOTUBULAR 1- MYOTUBULAR MYOPATHY 1 MTM1
X-lig recessive myotubular miopatia (XLMTM) é characterized by severe hypotonia and generalized caracterizadas por hipotonia severa e generalizada muscle weakness, with impaired maturation of muscle fraqueza muscular, comprometida com a maturação do músculo fibres. fibras. The gene responsible, MTM1, was identified O gene responsável, MTM1, foi identificado recently by positional cloning, and encodes a protein recentemente por clonagem posicional, e codifica uma proteína (myotubularin) with a tyrosine phosphatase domain (Myotubularin) com um domínio tirosina fosfatase (PTP). (PTP). Myotubularin is highly conserved through Myotubularin é altamente conservada através evolution and defines a new family of putative tyrosine evolução e define uma nova família de tirosina putativo phosphatases in man. fosfatases no homem. We report the identification of Nós relatamos a identificação de MTM1 mutations in 55 of 85 independent patients MTM1 mutações em 55 dos 85 pacientes independente screened by single-strand conformation polymorphism rastreada por polimorfismo de conformação em hélice simples for all the coding sequence. para toda a codificação da seqüência. Large deletions were grandes deleções foram observed in only three patients. observada em apenas três pacientes. Five point mutations Cinco mutações pontuais were found in multiple unrelated patients, accounting foram encontradas em vários pacientes não relacionados, contabilidade for 27% of the observed mutations. 27% das mutações observadas. The possibility of A possibilidade de detecting mutations and determining carrier status in a detecção de mutações e determinação do estatuto de transportadora em um disease with a high proportion of sporadic cases is of doença com uma elevada proporção de casos esporádicos, é de importance for genetic counselling. importância para o aconselhamento genético. More than half of Mais da metade dos XLMTM mutations are expected to inactivate the XLMTM mutações são esperados para a inativação dos putative enzymatic activity of myotubularin, either by atividade enzimática de myotubularin putativa, tanto por truncation or by missense mutations affecting the truncamento ou por mutações missense que afectam a predicted PTP domain. previu domínio PTP. Additional mutations are mutações adicionais são missenses clustered in two regions of the protein. missenses agrupado em duas regiões da proteína. Most A maioria of these affect amino acids conserved in the destes efeitos aminoácidos conservados na homologous yeast and Caenorhabditis elegans homólogo de levedura e Caenorhabditis elegans proteins, thus indicating the presence of other proteínas, indicando a presença de outros functional domains. domínios funcionais. INTRODUCTION INTRODUÇÃO X-linked X-linked recessive recessiva myotubular myotubular myopathy miopatia (XLMTM; (XLMTM; OMIM31040) is a congenital muscle disorder characterized by OMIM31040) é uma desordem muscular congênita, caracterizada por severehypotoniaandgeneralizedmuscleweakness.Spontaneous severehypotoniaandgeneralizedmuscleweakness.Spontaneous movements are weak or absent. movimentos são fracas ou inexistentes. Prenatal onset can often be início pré-natal pode muitas vezes ser indicated by polyhydramnios and decreased fetal movements. indicado por polyhydramnios e diminuição dos movimentos fetais. Miscarriages and stillbirths are frequently observed among Abortos e natimortos são freqüentemente observadas entre os obligate carriers. obrigar as transportadoras. No significant clinical symptoms or signs of Nenhum sintomas clínicos significativos ou sinais de myopathy occur in female carriers. miopatia ocorrer em portadores do sexo feminino. The characteristic muscle O músculo característica histopathology consists of small rounded muscle cells with histopatologia é constituído por pequenas células musculares arredondadas com centrallylocatednucleisurroundedbyahalodevoidofcontractile centrallylocatednucleisurroundedbyahalodevoidofcontractile elements. elementos. These resemble fetal myotubes, and it has been Estes se assemelham myotubes fetal, e tem sido suggested that the disorder results from an arrest in the normal sugeriram que a desordem resulta de uma prisão no normal development of muscle fibres (1). desenvolvimento das fibras musculares (1). XLMTM is usually lethal in XLMTM normalmente é letal em males because of respiratory failure. machos por causa de insuficiência respiratória. Most patients die within the A maioria dos pacientes morrem dentro do firstmonthsof life.Afewmaleshavesurvivedseveralyearswith life.Afewmaleshavesurvivedseveralyearswith firstmonthsof aspontaneousimprovementoftherespiratoryfunctionafterbirth. aspontaneousimprovementoftherespiratoryfunctionafterbirth. The reason for this clinical improvement is unknown. A razão para essa melhora clínica é desconhecida. Since the Desde o first report of myotubular myopathy (2), ∼ 100 cases have been primeiro relatório de miopatia myotubular (2), ~ 100 casos foram documented (3–5). documentado (3-5). Autosomal centronuclear/myotubular centronuclear Autosomal / myotubular myopathies (CNM) are related disorders with similar histo- miopatias (CNM) estão relacionados com doenças semelhantes histo- pathological findings, but the age of onset is later with a milder achados patológicos, mas a idade de início mais tarde com um suave clinical course (4). curso clínico (4). *To whom correspondence should be addressed. * A quem correspondência deve ser endereçada. Tel: +33 388 653244; Fax: +33 388 653246; Email: mandeljl@igbmc.u-strasbg.fr Tel: +33 388 653244, fax: +33 388 653246; mandeljl@igbmc.u-strasbg.fr: E-mail by on May 14, 2010 por em 14 de maio de 2010 http://hmg.oxfordjournals.org http://hmg.oxfordjournals.org Downloaded from Transferido de
--------------------------------------------------------------------------------
Page 2 Página 2
Human Molecular Genetics, 1997, Vol. Genética Molecular Humana, 1997, vol. 6, No. 9 6, n º 9 1506 1506 Table 1. SSCP primers and PCR conditions A Tabela 1. Primers SSCP e condições PCR Exon Exon limits Exon Exon limites Proximal primer primer Proximal Distal primer primer Distal PCR fragments PCR de fragmentos Annealing Final Recozimento Final Glycerol Glicerina 5 ′→ 3 ′ 5 '→ 3' 5 ′→ 3 ′ 5 '→ 3' size (nt) (Nt tamanho) (_C) (_C) mM MgCl mM MgCl 2 2 10% 10% 1 1 1–44 1-44 GGCGCCCAGTCCAACTTC GGCGCCCAGTCCAACTTC CCAAGGAGTCCCAACTTC CCAAGGAGTCCCAACTTC 455 455 52 52 1.5 1,5 – - 2 2 45–117 45-117 AGAACCTGTAAAGTAGTACC AGAACCTGTAAAGTAGTACC TAGGCCAGCCCAAAATGAC TAGGCCAGCCCAAAATGAC 272 272 52 52 1.5 1,5 – - 3 3 118–190 118-190 AACAGTGTGTAAATGTAACGTC AACAGTGTGTAAATGTAACGTC AGACTTCTCCTCAAGTTATGC 172 AGACTTCTCCTCAAGTTATGC 172 55 55 1.5 1,5 + + 4 4 191–285 191-285 AGTGCCATTTGTTGTGTATC AGTGCCATTTGTTGTGTATC TGACCCACAGTCAATCTTGC TGACCCACAGTCAATCTTGC 255 255 55 55 1.5 1,5 + + 5 5 286–396 286-396 TAATTATACTGACAGAAATACTG TAATTATACTGACAGAAATACTG TCCACATTAATTGTCTACTATC 234 TCCACATTAATTGTCTACTATC 234 55 55 2 2 – - 6 6 397–498 397-498 TTGAAGACTGAACTGTCATAC TTGAAGACTGAACTGTCATAC AACCTTCCCACGCTGAGG AACCTTCCCACGCTGAGG 175 175 55 55 1.5 1,5 – - 7 7 499–582 499-582 AGATGTACTATAATAGTAGAC AGATGTACTATAATAGTAGAC AGGTTCATCACATACCAGAC AGGTTCATCACATACCAGAC 188 188 52 52 1.5 1,5 – - 8 8 583–732 583-732 TCCAGAGATGAGGTCAAGC TCCAGAGATGAGGTCAAGC GGTGCTCTTCAAGAGAAACG 239 GGTGCTCTTCAAGAGAAACG 239 55 55 1.5 1,5 + + 9 9 733–921 733-921 TTGATAGCTTAAACTTTCTGAC TTGATAGCTTAAACTTTCTGAC TCCAGCACATCATTAAGTCC TCCAGCACATCATTAAGTCC 247 247 55 55 1.5 1,5 – - 10 10 922–1107 922-1107 CTGATTGTTTGTATTTCATG CTGATTGTTTGTATTTCATG TATATACACAAATATTTTCAC TATATACACAAATATTTTCAC 251 251 52 52 2 2 + + 11 11 1108–1314 1108-1314 AACTCCCTACTGACTCACG AACTCCCTACTGACTCACG AATCCTGAATGGTAGTGATCT 292 AATCCTGAATGGTAGTGATCT 292 55 55 1.5 1,5 + + 12 12 1315–1407 1315-1407 ATGCTTTCTCAGTTTTGTACC ATGCTTTCTCAGTTTTGTACC TAAACAATGAGTTGAATGTA TAAACAATGAGTTGAATGTA 195 195 52 52 2 2 + + 13 13 1408–1521 1408-1521 TTATAAAGTTTCAGTCCCAG TTATAAAGTTTCAGTCCCAG TTTGGCAAGCCTAATGTATC TTTGGCAAGCCTAATGTATC 211 211 52 52 2 2 + + 14 14 1522–1698 1522-1698 TTTTACTTAGGCTCTCCAC TTTTACTTAGGCTCTCCAC CTATCTTTTAACAGTGCTAC CTATCTTTTAACAGTGCTAC 248 248 52 52 2 2 + + 15 15 1699–3411 1699-3411 AGTGTAACTCAAGTCTCTGG AGTGTAACTCAAGTCTCTGG AAATGAAAGTCAGCTATCGC AAATGAAAGTCAGCTATCGC 256 256 52 52 1.5 1,5 + + Exons a, b, c, d and e from Laporte et al . Exons a, b, c, d, e de Laporte et al. (13) are numbered respectively exon 8, 9, 11, 14 and 15. (13) são numeradas respectivamente exon 8, 9, 11, 14 e 15. The stop codon is 1863–1865. O códon é 1863-1865. The locus responsible for the disease ( MTM1 ) was mapped to O locus responsável pela doença (MTM1) foi mapeada para Xq28 by linkage analysis (6,7). Xq28 por análise de ligação (6,7). By combining linkage analysis Ao combinar a análise do enlace with the study of patients carrying deletions, we restricted the com o estudo de pacientes portadores de deleções, que restringiu o candidate region to 280 kb (8–12), and the MTM1 gene was região candidata a 280 kb (12/08), eo gene foi MTM1 isolated recently by a positional cloning strategy (13). isolados recentemente por uma estratégia de clonagem posicional (13). The MTM1 O MTM1 gene is ubiquitously expressed and shows a muscle-specific gene é expresso de forma onipresente e mostra um músculo específico alternative transcript due to the use of a different polyadenylation Transcrição alternativos devido ao uso de um poliadenilação diferentes signal. sinal. It encodes a protein which contains the consensus sequence Ele codifica uma proteína que contém a seqüência consenso for the active site of tyrosine phosphatases, a wide class of proteins para o sítio ativo das fosfatases de tirosina, uma ampla classe de proteínas involved in signal transduction, control of cell growth and envolvidas na transdução de sinais, controle do crescimento celular e differentiation. diferenciação. The MTM1 gene product (myotubularin) is highly O produto do gene MTM1 (myotubularin) é altamente conserved in Saccharomyces cerevisiae and Caenorhabditis conservados em Saccharomyces cerevisiae e Caenorhabditis elegans , which is surprising for a gene implicated in a elegans, que é surpreendente para um gene implicado em um muscle-specific disorder. Específicos desordem muscular. Three new homologous human genes Três novos genes homólogos humanos were found, and, together with MTM1 , they define a new family foram encontradas, e, juntamente com MTM1, definem uma nova família of putative tyrosine phosphatases in man (13). de tirosina fosfatases putativo no homem (13). The cloning of the MTM1 gene has greatly improved the A clonagem do gene MTM1 melhorou muito a prospects for diagnosis and genetic counselling of the disease. perspectivas para o diagnóstico e aconselhamento genético da doença. Moreover,identificationofthemutationsresponsibleforXLMTM Além disso, identificationofthemutationsresponsibleforXLMTM should give some insights into its molecular and physiological deve dar alguns insights sobre sua estrutura molecular e fisiológico basis. base. We have determined the exon–intron structure of the MTM1 Nós determinamos a estrutura intron-exon do MTM1 gene (Laporte et al ., in preparation), and performed mutation (Laporte et al gene., Em preparação), realizada mutação e screening in 85 independent patients. seleção em 85 pacientes independente. Mutations were found in 55 Mutações foram encontradas em 55 of them, and this allows accurate counselling in the relevant deles, e isso permite o aconselhamento precisos nos respectivos families. famílias. The identification of 19 missense mutations and small A identificação de 19 mutações missense e pequenas empresas insertions or deletions of amino acids should be useful for inserções ou deleções de aminoácidos deve ser útil para functional studies of myotubularin. Estudos funcionais de myotubularin. RESULTS RESULTADOS The MTM1 gene, located in the proximal part of Xq28, consists O gene MTM1, localizado na parte proximal do Xq28, consiste of 15 exons, for which flanking intronic sequences have been de 15 exons, para as quais flanqueiam seqüências intrônicas foram determined (Laporte et al ., in preparation). determinado (Laporte et al., em preparação). In the original No original description of the cDNA sequence, the location of the translation descrição da seqüência do DNA, a localização da tradução initiation site had not been determined. site início não havia sido determinado. More recent data using Os dados mais recentes com antibodies directed against myotubularin indicate that the protein anticorpos dirigidos contra myotubularin indicam que a proteína is translated starting from the methionine codon at position 19 in é traduzida a partir do códon de metionina na posição 19 no the putative amino acid sequence previously reported [(13), o ácido amino seqüência putativa previamente relatados [(13), GenBankU46024].Theendogenousproteinimmunoprecipitated GenBankU46024]. Theendogenousproteinimmunoprecipitated from myoblast extracts has the same size as that synthesized in a partir de extractos myoblast tem o mesmo tamanho que sintetizados em COS cells transfected with the full-length cDNA, where the first COS células transfectadas com o cDNA completo, onde o primeiro ATG codon is at position 19 (unpublished results). códon ATG está na posição 19 (resultados não publicados). We have thus Temos, assim, renumbered the amino acid positions. numeradas as posições de aminoácidos. The MTM1 gene was screened for mutations using single-strand O gene MTM1 foi selecionado para mutações usando single-strand conformation polymorphism (SSCP) followed by sequencing of polimorfismo de conformação (SSCP) seguido de seqüenciamento de abnormal bands, based on the knowledge of intronic sequences bandas anormais, com base no conhecimento de seqüências intrônicas flankingallofthe15exons(seeprimersandconditionsinTable 1). flankingallofthe15exons (seeprimersandconditionsinTable 1). Among 85 patients screened for mutations for all the coding Entre os 85 pacientes selecionados para mutações para todos os códigos sequence, we found 52 point mutations (Table 2). seqüência, foram encontradas 52 mutações pontuais (Tabela 2). Three patients Três pacientes had large deletions. tinha grandes deleções. Seven of the point mutations and two large Sete das mutações de ponto e dois grandes deletionswerereportedpreviously(11,13). deletionswerereportedpreviously (11,13). The 52 point mutations O ponto de mutação 52 consist of 33 base changes and 19 small insertions/deletions. composto por base as alterações 33 e 19 pequenas inserções / deleções. Sixteen of the base substitutions affect CpG dinucleotides. Dezesseis das substituições base afetar dinucleotídeos CpG. Twenty Vinte seven mutations are frameshift or nonsense mutations. sete mutações frameshift ou nonsense mutações. Alteration Alteração of donor or acceptor splice sites account for six of the mutations. do doador ou receptor de splice sites responsáveis por seis das mutações. Including the large deletions, 65% of the mutations would result in Incluindo os grandes deleções, 65% das mutações que resultam em the absence or truncation of myotubularin. a ausência ou o truncamento de myotubularin. An A(1314–10)G change in intron 11 was found in four Um A (1314-1310) G mudança no intron 11 foi encontrado em quatro unrelated patients and creates a new functional acceptor site that pacientes não relacionados e cria um site funcional aceitador novo leads to the insertion of three amino acids in a conserved region leva para a inserção de três aminoácidos em uma região conservada of the protein as indicated by RT-PCR experiments (14,28). da proteína tal como indicado pela RT-PCR experimentos (14,28). Missense mutations were found concentrated in three areas: Mutações foram encontradas concentrados em três áreas: exons4 and 5,exons8and9andexons11and12(Fig.1).Atleast exons4 e 5, exons8and9andexons11and12 (Fig.1). Atleast 12 of the 16 different missenses or single amino acid deletions 12 dos 16 missenses diferentes ou deleções amino ácido único affect residues that are completely conserved in the homologous afectar os resíduos que são completamente conservada no homólogo proteins predicted from yeast and C.elegans sequences (13), as proteínas preditas a partir de leveduras e seqüências C.elegans (13), como indicated in Table 2. indicados na Tabela 2. The N-terminal domain of myotubularin O N-terminal do domínio myotubularin (fromexons2to7)isonlyweaklyhomologoustoitscounterparts (Fromexons2to7) isonlyweaklyhomologoustoitscounterparts in yeast and C.elegans , making the alignment less reliable. no fermento e C.elegans, fazendo o alinhamento menos confiável. The O four other missense mutations are in any case non-conservative outros quatro mutações missense são em qualquer caso, não-conservadores (delK47,R69C,L70FandS229P).Wetestedallexonsonatleast (DelK47, R69C, L70FandS229P). Wetestedallexonsonatleast 40 normal chromosomes under the same SSCP conditions, and 40 cromossomos normais e sob a SSCP mesmas condições, e did not find these mutations. não encontraram estas mutações. This further supports the conclusion Estes resultados corroboram a conclusão that these alterations are indeed disease causing. que essas alterações são efectivamente causar doença. by on May 14, 2010 por em 14 de maio de 2010 http://hmg.oxfordjournals.org http://hmg.oxfordjournals.org Downloaded from Transferido de
--------------------------------------------------------------------------------
Page 3 Página 3
1507 1507 Nucleic Acids Research, 1994, Vol. Nucleic Acids Research, 1994, vol. 22, No. 1 22, No. 1 Human Molecular Genetics, 1997, Vol. Genética Molecular Humana, 1997, vol. 6, No. 9 1507 6, n º 9 1507 Table 2. Mutations in the MTM1 gene Tabela 2. Mutações no gene MTM1 Patient Paciente a um Exon Exon Nucleotide change Nucleotide mudança b b Predicted protein or Previsão de proteína ou Yeast or Levedura ou Age at death Idade no momento da morte e e Mutation origin origem da mutação f f Referring Referindo-se Ref. Ref. intron intron splicing alteration alteração splicing c c C.elegans aa aa C.elegans d d physician médico N1-44 N1-44 ex2 ex2 G103T G103T E17X E17X mc mc PG Barth/P. PG Barth / P. Bolhuis Bolhuis 4399 4399 ex3 ex3 C124T* C124T * R24X R24X E. Flory E. Flory G92-628 G92-628 ex3 ex3 C163T* C163T * R37X R37X mc mc W. Kress W. Kress NL16 NL16 ex3 ex3 C163T* C163T * R37X R37X maternal maternal PG Barth/ Barth / PG P. Bolhuis P. Bolhuis 1-3228 1-3228 in3 in3 (191–4)delATAG (191-4) delATAG destroy acceptor destruir aceitador 7 months 7 meses C. Francannet C. Francannet splice site local da tala CNM25 CNM25 ex4 EX4 193delAAA 193delAAA K47del K47del A/E(?) A / E (?) 11 months 11 meses mc mc E. Kattner E. Kattner CNM10 CNM10 ex4 EX4 195delAGAA 195delAGAA frameshift 48 frameshift 48 6 months 6 meses mc mc W. Kress/T. Kress W. T. / Grimm Grimm 14 14 CNM17 CNM17 ex4 EX4 195delAGAA 195delAGAA frameshift 48 frameshift 48 1 month Um mês mc mc E. Bertini E. Bertini CNM21 CNM21 ex4 EX4 195delAGAA 195delAGAA frameshift 48 frameshift 48 8 and 10 days 8 e 10 dias mc mc M. Huggins/ Huggins M. / T. Costa T. Costa 4715 4715 ex4 EX4 C259T* C259T * R69C R69C H/R (?) H / R (?) still alive at 3 years ainda vivo em 3 anos N. Dahl N. Dahl NL20 NL20 ex4 EX4 C262T C262T L70F L70F T/Q (?) T / Q (?) G. van Wijngaarden/ G. van Wijngaarden / P. Barth P. Barth DA1 DA1 ex4 EX4 266delATTT 266delATTT Y71X Y71X grand paternal Grande paternal S. Manouvrier-Hanu Manouvrier S. Hanu- 16 16 G93-652 G93-652 ex5 EX5 T314C T314C L87P L87P L/L (?) L / L (?) still alive at 3 years ainda vivo em 3 anos W. Kress W. Kress DF34 DF34 ex5 EX5 351insCG 351insCG frameshift 100 frameshift 100 mc mc Boute/Pevissen Boute / Pevissen CU15 CU15 in5 IN5 A(397–2)C A (397-2) C destroy acceptor destruir aceitador J. Boue J. Boue splice site local da tala 4711 4711 ex6 EX6 451delAT 451delAT frameshift 133 frameshift 133 neonatal/alive neonatal / vivo Kubota Kubota at 7 years em 7 anos CNM1 CNM1 ex7 EX7 515del18bp and 515del18bp e L154X L154X 3 days 3 dias mc mc S. Braga S. Braga 515insAAA 515insAAA CNM22 CNM22 ex7 EX7 G(582+1)A G (582 +1) A destroy donor destruir doador S. Liechti-Gallati S. Liechti-Gallati splice site local da tala 3096 3096 ex8 EX8 A620G A620G N189S N189S N/N N / N 3 months 3 meses maternal maternal N. Dahl N. Dahl CNM32 CNM32 ex8 EX8 643delACTT 643delACTT frameshift 198 frameshift 198 3 weeks 3 semanas D. Lev Lev D. 13 13 GM-06813 GM-06813 ex8 EX8 646delT and C648A 646delT e C648A frameshift 198 frameshift 198 10 months 10 meses mc mc NHGMCR NHGMCR g g 13 13 CNM23/G90-520 CNM23/G90-520 ex8 EX8 C668T* C668T * P205L P205L P/P P / P 2 months 2 meses maternal maternal W. Kress/R. W. Kress / R. Kraschl Kraschl 13 13 CNM2 CNM2 ex8 EX8 703insG 703insG frameshift 217 frameshift 217 4 and 5 days 4 e 5 dias mc mc S. Braga S. Braga CNM28 CNM28 ex8 EX8 C718T* C718T * R222X R222X still alive at ainda vivo na B. Wittwer/ Wittwer B. / 14 years 14 anos B. Lemcke B. Lemcke CNM20 CNM20 ex8 EX8 C724T* C724T * R224X R224X maternal maternal S. Liechti-Gallati S. Liechti-Gallati CU32 CU32 ex8 EX8 C724T* C724T * R224X R224X MP Cordier-Alex MP-Cordier Alex G93-401 G93-401 ex8 EX8 C724T* C724T * R224X R224X 6 months 6 meses maternal maternal W. Kress W. Kress G93-258 G93-258 in8 in8 (732+1)delG (732 +1) delG destroy donor destruir doador 6 months 6 meses W. Kress W. Kress splice site local da tala CNM9 CNM9 in8 in8 G(733–1)A G (733-1) A destroy acceptor destruir aceitador 22 days 22 dias grand maternal Grande maternal G. Wolff G. Wolff 14 14 splice site local da tala DY89 DY89 ex9 EX9 T739C T739C S229P S229P T/I T / I still alive at 1 year vivo em um ano ainda W. Kress W. Kress 3097 3097 ex9 EX9 763delAC 763delAC frameshift 237 frameshift 237 N. Dahl N. Dahl 13 13 CNM19 CNM19 ex9 EX9 763insA 763insA frameshift 237 frameshift 237 mc mc MC Zahller MC Zahller NL15 NL15 ex9 EX9 C775T* C775T * R241C R241C R/R R / R still alive at 4 years ainda vivo, em 4 anos mc mc PG Barth/P. PG Barth / P. Bolhuis Bolhuis CNM12 CNM12 ex9 EX9 819delA 819delA frameshift 256 frameshift 256 1 month Um mês grand paternal Grande paternal A. Schinzel/ Schinzel / A. E. Boltshauser E. Boltshauser CNM8 CNM8 ex9 EX9 890delC 890delC frameshift 279 frameshift 279 still alive at 8 years ainda vivo em 8 anos mc mc H. Jacobi H. Jacobi MA3 MA3 ex11 EX11 1147insT 1147insT frameshift 365 frameshift 365 N. Dahl N. Dahl 13 13 CF88 CF88 ex11 EX11 G1181A G1181A S376N S376N S/S S / S 7 months 7 meses grand parental Grande parental Chery/Vigneron Chery Vigneron / 13 13 IT TI ex11 EX11 G1186A* G1186A * G378R G378R G/G G / G 2 weeks Duas semanas N. Dahl N. Dahl 13 13 CNM14 CNM14 ex11 EX11 1233insGTTG 1233insGTTG frameshift 394 frameshift 394 2 months 2 meses mc mc W. Kress/E. W. Kress / E. Passarge Passarge MT65 MT65 ex11 EX11 A1244G A1244G Y397C Y397C Y/Y Y / Y 29 days 29 dias maternal maternal F. Samson F. Samson 15 15 G95–127 G95-127 ex11 EX11 G1259C G1259C G402A G402A G/G G / G W. Kress W. Kress CNM16 CNM16 in11 in11 G(1314+1)C G (1314 +1) C destroy donor destruir doador mc mc A. Steen A. Steen splice site local da tala CNM4 CNM4 in11 in11 A(1315–10)G: Uma 1315-1310) G (: 420insFIQ 420insFIQ 6 months 6 meses G. Wolff/ G. Wolff / new splice site splice site novo D. Emmerich D. Emmerich CNM15 CNM15 in11 in11 A(1315–10)G: Uma 1315-1310) G (: 420insFIQ 420insFIQ 3 months 3 meses H. Schroeder/ H. Schroeder / 14 14 new splice site splice site novo J. Sonntag J. Sonntag MTMFIN2 MTMFIN2 in11 in11 A(1315–10)G: Uma 1315-1310) G (: 420insFIQ 420insFIQ 11 months 11 meses L. Pääkkönen/ Pääkkönen L. / new splice site splice site novo L. Paljärvi L. Paljärvi by on May 14, 2010 por em 14 de maio de 2010 http://hmg.oxfordjournals.org http://hmg.oxfordjournals.org Downloaded from Transferido de
--------------------------------------------------------------------------------
Page 4 Página 4
Human Molecular Genetics, 1997, Vol. Genética Molecular Humana, 1997, vol. 6, No. 9 6, n º 9 1508 1508 Table 2. Continued Tabela 2. Continua EA5 EA5 in11 in11 A(1315–10)G: Uma 1315-1310) G (: 420insFIQ 420insFIQ maternal maternal K. Tezcan K. Tezcan new splice site splice site novo G92-120 G92-120 ex12 ex12 G1316A* G1316A * R421Q R421Q R/R R / R 3 months 3 meses W. Kress W. Kress GM-10680 GM-10680 ex12 ex12 G1345A* and * G1345A e D431N and D433N D431N e D433N D/D and D/D D / D e D / D 6 weeks 6 semanas mc mc NHGMCR NHGMCR g g G1351A G1351A NL21 NL21 ex13 EX13 A1460C A1460C H469P H469P H/H H / H PG Barth/P. PG Barth / P. Bolhuis Bolhuis CNM5 CNM5 ex13 EX13 C1474T* C1474T * R474X R474X mc mc E. Boltshauser E. Boltshauser DM92 DM92 ex13 EX13 C1474T* C1474T * R474X R474X 2 weeks Duas semanas N.Piquion N. Piquion 1-3884 1-3884 ex13 EX13 C1474T* C1474T * R474X R474X 3 weeks 3 semanas Jarreau Jarreau CM73 CM73 del del from ex2 to de ex2 para J. Boue/ Boue J. / ex 8 included 8 ex incluído JA Urtizberea JA Urtizberea G89-441 G89-441 del del from ex1 to a partir de ex1 11 months 11 meses W. Kress W. Kress 11 11 ex13 included EX13 incluído G89-474 G89-474 del del all gene deleted todos os genes suprimidos 3 months 3 meses W. Kress W. Kress 11 11 a um Each patient represents one family. Cada paciente representa uma família. For DA1 and CNM5, CNM10, CNM14 and CNM19, maternal DNA was analysed, as no DNA was available from the affected Para DA1 e CNM5, CNM10, CNM14 e CNM19, DNA materno foi analisado, pois não estava disponível DNA do afetado boys. meninos. b b Sequence changes are presented according to the nomenclature proposed by the Ad Hoc Committee on Mutation Nomenclature (27). As alterações na seqüência são apresentados de acordo com a nomenclatura proposta pelo Comitê Ad Hoc sobre Mutação Nomenclatura (27). Nucleotide numbers refer Nucleotide números referem-se to their positions in the sequence of the MTM1 transcript (GenBank U46024). para as suas posições na seqüência da transcrição MTM1 (GenBank U46024). Starred nucleotide changes affect a CpG dinucleotide. alterações nucleotídicas favoritas afetar um dinucleotídeo CpG. c c The amino acid numbering starts at the first methionine of the open reading frame [codon 19 in (13)]. O aminoácido numeração começa no primeiro metionina do quadro de leitura aberta [codon 19, em (13)]. The numbering has therefore been modified, for the mutations A numeração foi assim modificado, para as mutações previously reported (13). relatado anteriormente (13). d d In regions where the homology between myotubularin and yeast or C.elegans homologues is low (N-terminal domain of the protein), a question mark indicates Nas regiões onde a homologia entre myotubularin e levedura ou homólogos C.elegans é baixa (N-terminal do domínio da proteína), um ponto de interrogação indica that the alignment is ambiguous. que o alinhamento é ambíguo. e e In a few cases, two brothers were affected, and their age at death is indicated. Em alguns casos, dois irmãos foram afetadas, e sua idade no momento da morte é indicado. f f In the mutation origin column, mc means that the mother carries the mutation, other mentions (maternal, grand paternal etc.) indicate the origin of a new mutation. Na coluna de origem da mutação, mc significa que a mãe carrega a mutação, que não menciona (maternal, paternal grand etc) indicam a origem de uma nova mutação. g g NHGMCR stands for Nigms Human Genetic Mutant Cell Repository. NHGMCR representa NIGMS Human Genetic Mutant Cell Repository. Table 3. Polymorphisms and rare variants Tabela 3. Polimorfismos e variantes raras Exon/ Exon / Nucleotide change Nucleotide mudança Frequency Freqüência intron intron in2 in2 (118–50)delAG (118-50) delAG 1/128 1 / 128 in2 in2 (118–50)A/T (118-50) A / T 1/128 1 / 128 in2 in2 (118–14)T/C (118-14) T / C 1/128 1 / 128 ex8 EX8 615T/C wobble base 615T / oscilação base C 1/150 1 / 150 ex9 EX9 738G/C wobble base 738G / oscilação base C 1/150 1 / 150 ex11 EX11 1308T/C wobble base 1308T / C oscilação base 2/150 2 / 150 in11 in11 (1315–19)T/G (1315-1319), T / G 2/150 2 / 150 in11 in11 (1314+3)A/G consensus donor site (1314 3) A / G sítio doador consenso 23/47 23/47 in11 in11 (1314+17)A/G (1314 17) A / G 3/150 3 / 150 ex15 EX15 a um 1755C/T wobble base 1755C / T base oscilação 1/150 1 / 150 Rare variants were found in either normal individuals or in patients carrying a variantes raras foram encontradas em ambos os indivíduos normais ou em pacientes portadores de uma characterized mutation, except for 1755C/T, found in a patient for whom no mutação caracteriza-se, exceto para 1755C / T, encontrada em um paciente para quem não mutation has been detected yet. mutação foi detectada ainda. The first base indicated corresponds to the com- A primeira base indicada corresponde ao com- mon allele and the frequency is calculated for the rare allele. alelo seg ea freqüência é calculado para o alelo raro. a um See Laporte et al . Veja Laporte et al. (13). (13). Although no point mutations were found in exons 1, 10, 14and Embora não mutações foram encontradas nos exons 1, 10, 14e 15, our results are consistent with a widespread occurrence of 15, nossos resultados são consistentes com a ocorrência generalizada de mutations along the gene. mutações ao longo do gene. The C-terminal end of the protein may O terminal de fim-C da proteína pode be of lesser functional importance as it is not well conserved in ser de menor importância funcional, pois não está bem conservada yeast and C.elegans , and as one would expect ∼ 10 mutations in levedura e C.elegans, e como seria de esperar ~ 10 mutações no exons 14 + 15, based on the length of their coding sequences. exons 14 + 15, com base no comprimento de suas seqüências de codificação. Exons 4, 8, 9, 11 and 12 showed a higher tendency to mutate in Exons 4, 8, 9, 11 e 12 apresentam uma maior tendência a se transformar em this panel of patient samples. deste painel de amostras de pacientes. Polymorphisms Polimorfismos Ten polymorphisms or rare variants have been characterized to Dez ou polimorfismos variantes raras foram caracterizados para date (Table 3). data (Tabela 3). The T → C transition at position 615 affects a A transição T → C na posição 615 afeta uma wobble base and was found in only one patient (CU32) who base oscilação e foi encontrada em apenas um paciente (CU32), que carries a deleterious mutation (R224X). portador de uma mutação deletéria (R224X). The (1314+17)A/G was O (1314 17) A / G foi found in G93-401, who already has the same R224X mutation, encontrados em G93-401, que já tem a mutação R224X mesmo, and in two normal chromosomes (15). e em dois cromossomos normais (15). The frequent A freqüente (1314+3)A/G polymorphism is located in the donor splice site of (1314 3) A / G polimorfismo está localizado no local fornecedor da tala do intron 11. intron 11. It is unlikely that it affects the splicing efficiency in the É pouco provável que isso afeta a eficiência de emenda no normal population as G or A are equally accepted at the +3 população normal como G ou A são igualmente admitidos no 3 position of the consensus donor site. posição do site doador consenso. The 1755C/T variant that O 1755C / T variante que doesnotaffecttheaminoacidsequencewasfoundinapatientfor doesnotaffecttheaminoacidsequencewasfoundinapatientfor whom no other mutation has yet been observed, but this variant quem não tem outra mutação ainda não foi observada, mas esta variante is unlikely to be pathological. É improvável que seja patológico. Large deletions grandes deleções Three large deletions encompassing part or all of the MTM1 gene Três grandes deleções envolvendo parte ou a totalidade do gene MTM1 werefound,includingtwopreviouslyreportedones(11).Patients , Includingtwopreviouslyreportedones (11). Pacientes werefound G89-441 and G89-474 carried the largest deletions and were also G89 e G89-441-474 levou a maior supressões e também foram found to have an abnormal genital development (hypospadias). encontrada para ter um desenvolvimento genital anormal (hipospádias). Patient CM73, who shows an intragenic deletion encompassing Paciente CM73, que mostra um abrangente eliminação intragenic exons2–8,hadnormalgenitaliaandnoadditionalphenotypes.As exons2-8, hadnormalgenitaliaandnoadditionalphenotypes.As proposed previously (11), these findings suggest that a gene proposta anteriormente (11), estes resultados sugerem que um gene centromeric to MTM1 is important for male genital development. centromérica de MTM1 é importante para o desenvolvimento genital masculino. Recurrent and new mutations e novas mutações recorrentes The nonsense mutations R37X, R224X and R474X, As mutações nonsense R37X, R224X e R474X, corresponding to C → T transitions at CpG sites, were found in correspondente a transições C → T em locais CpG, foram encontrados em two, three and three independent families, respectively. dois, três e três famílias independentes, respectivamente. A 4 bp A BP 4 frameshift deletion in exon 4 was found in three patients. supressão frameshift no exon 4 foi encontrada em três pacientes. This Este recurrent deletion does not correspond to a replication slippage supressão recorrente não corresponde a uma derrapagem de replicação affecting a tandem repeat, a frequently observed cause of small afectando uma repetição em tandem, uma causa frequentemente observada de pequenas deletions. exclusões. The splice mutation in intron 11 (A 1314–10G) which A mutação da tala no intron 11 (A 1314-10G), que by on May 14, 2010 por em 14 de maio de 2010 http://hmg.oxfordjournals.org http://hmg.oxfordjournals.org Downloaded from Transferido de
--------------------------------------------------------------------------------
Page 5 Página 5
1509 1509 Nucleic Acids Research, 1994, Vol. Nucleic Acids Research, 1994, vol. 22, No. 1 22, No. 1 Human Molecular Genetics, 1997, Vol. Genética Molecular Humana, 1997, vol. 6, No. 9 1509 6, n º 9 1509 Figure1. Distributionofmutationsalongtheopenreadingframeofthe MTM1 transcript.Exonsaredrawntoscale,numbered1–15,andtheirboundariesareindicated. Figura1. Distributionofmutationsalongtheopenreadingframeofthe MTM1 transcript.Exonsaredrawntoscale, numbered1-15, andtheirboundariesareindicated. The 5 ′ and 3 ′ untranslated sequences (UTRs) are in grey. A 5 'e 3' seqüências não traduzidas (UTRs) estão em cinza. The 2.4 kb muscle- and testis-specific transcript and the 4.0 kb ubiquitous transcript differ only by the length De 2,4 kb músculo-transcrição e testículo-específicos e transcrição 4,0 kb onipresente diferem apenas pelo comprimento of the 3 ′ UTR. da 3 'UTR do. The putative tyrosine phosphatase active site is indicated in exon 11. A tirosina fosfatase suposto sítio ativo é indicado no exon 11. Recurrent mutations in unrelated patients are vertically aligned. mutações recorrentes em pacientes não aparentados são alinhados verticalmente. Large deletions grandes deleções occurring in patients G89-441, G89-474 and CM73 are represented by the upper lines. ocorre em pacientes G89-441, G89-474 e CM73 são representados pelas linhas superior. was found four times, shows no obvious feature that could foi encontrado quatro vezes, não apresenta nenhuma característica óbvia que poderia account for its high incidence. conta de sua alta incidência. Patients showing the same mutation were analysed with Os pacientes que apresentam a mesma mutação foram analisados com microsatellites in the MTM1 region [ DXS8377 and 7423 (17)] microssatélites na região MTM1 [DXS8377 e 7423 (17)] which confirmed that they were from different families (not que confirmou que eles eram de famílias diferentes (não shown),exceptforpatientsCNM15andEA5whocarrythesplice mostrados), exceptforpatientsCNM15andEA5whocarrythesplice mutationinintron11onthesamehaplotype.ThemutationinEA5 mutationinintron11onthesamehaplotype.ThemutationinEA5 is a maternal new mutation, indicating that the mutations in EA5 é uma nova mutação materna, indicando que as mutações no EA5 and CNM15 are independent. CNM15 e são independentes. AlthoughinmanycaseswedidnothaveDNAfromthemother AlthoughinmanycaseswedidnothaveDNAfromthemother or other family members to trace the inheritance of the mutation, ou outros membros da família para traçar a herança da mutação, in the cases where such analyses could be performed, we found nos casos em que tais análises poderão ser realizadas, encontramos a high proportion of maternal or grandparental new mutations. uma elevada percentagem da mortalidade materna ou grandparental novas mutações. In Em particular, seven of 28 mothers tested did not carry their son’s particular, sendo sete de 28 mães testadas não levar seu filho mutation, which is close to the expected one-third (Table 2). mutação, que está próximo ao esperado de um terço (Tabela 2). DISCUSSION DISCUSSÃO The MTM1 gene, which encodes a 603 amino acid protein, was O gene MTM1, que codifica uma proteína de 603 aminoácidos, foi screened for mutations in 85 patients by SSCP analysis, over all triagem de mutações em 85 pacientes pela análise de SSCP, de todos os the coding sequence. a seqüência de codificação. Fifty five mutations and 10 polymorphisms Cinqüenta e cinco mutações e 10 polimorfismos and rare variants were identified. e variantes raras foram identificados. As expected for a lethal Como esperado para um letal X-linked disease, we found a high heterogeneity of mutations, Doença ligada ao X, encontramos uma grande heterogeneidade de mutações, widespread through the coding sequence, of which a high difundida através da seqüência de codificação, de que um alto proportion were new mutations. proporção foram novas mutações. Truncated proteins are predicted proteínas truncadas são previstos to result from ∼ 65% of the mutations. resultar de ~ 65% das mutações. Five recurrent mutations account for nearly one-third of all Cinco mutações recorrentes representam quase um terço de todos os mutations, and single nucleotide changes affect preferentially mutações e mudanças de um único nucleotídeo afetam preferencialmente CpG dinucleotides. dinucleotídeos CpG. The only exception is the splice mutation in A única exceção é a mutação da tala em intron 11 resulting in the insertion of three amino acids (FIQ) at intron 11 resultando na inserção de três aminoácidos (FIQ) em position420andobservedinfourindependentpatients.Thereare position420andobservedinfourindependentpatients.Thereare no obvious sequence features that may account for the high não óbvias características seqüência que pode explicar o alto incidence of this mutation (also observed by de Gouyon incidência dessa mutação (também observado por de Gouyon et al ., 28), and for the recurring 4 bp deletion in exon 4 et al., 28), e para o apagamento de 4 bp no exon 4 recorrentes (195delAGAA). (195delAGAA). The parental origin of these mutations is under A origem parental das mutações está sob investigation. investigação. The number of mutations found is lower than expected, O número de mutações encontradas é inferior ao esperado, considering that we screened all the coding sequence. considerando que nós analisamos toda a codificação da seqüência. This might Isso pode be accounted for by preferential localization of mutations in ser explicado pela localização preferencial de mutações em regions not yet analysed (regulatory sequences, introns) or by the regiões ainda não analisadas (seqüências reguladoras, íntrons) ou pelo fact that we did not detect all mutations by SSCP analysis. fato de que nós não detectar todas as mutações por análise de SSCP. As Como sporadic cases account for a high proportion of the patients, some casos esporádicos são responsáveis por uma elevada proporção de pacientes, alguns patientsmaynothaveXLMTM.Wecannotexcludethepossibility, patientsmaynothaveXLMTM.Wecannotexcludethepossibility, at least in a small proportion of patients, of another gene defect pelo menos em uma pequena proporção de pacientes, de outro defeito genético causingasimilarphenotype.Wereportedrecentlythefindingofan causingasimilarphenotype.Wereportedrecentlythefindingofan MTM1 mutation in a family previously thought to indicate genetic MTM1 mutação em uma família que se pensava para indicar genética heterogeneity in XLMTM (18). heterogeneidade na XLMTM (18). There is thus no more evidence of Assim, não há mais evidências de genetic heterogeneity in proven X-linked cases (15). heterogeneidade genética comprovada em casos ligados X (15). Diagnostic applications aplicações de diagnóstico TheproportionofsporadiccasesinanX-linkedlethaldiseaselike TheproportionofsporadiccasesinanX-linkedlethaldiseaselike XLMTM is >50%. XLMTM é> 50%. Genetic counselling is especially difficult in O aconselhamento genético é especialmente difícil em such cases, as there is no reliable way of assessing carrier status tais casos, como não há nenhuma maneira fiável de avaliar o estado de portador in females (4,15). no sexo feminino (4,15). Direct mutation detection thus becomes the A detecção directa de mutação torna-se assim a most reliable method for prenatal diagnosis and carrier detection método mais confiável para o diagnóstico pré-natal e detecção de portadores (13,14). (13,14). Exons 4, 8, 9, 11 and 12 showed a higher tendency to Exons 4, 8, 9, 11 e 12 apresentam uma maior tendência para mutate and may be tested first. mutação e pode ser testada primeiro. Together, these five exons Juntos, estes cinco exons accounted for 73% of all the mutations found. representaram 73% de todas as mutações encontradas. Three of the Três dos recurrent mutations are included in these five exons. mutações recorrentes estão incluídos nestes cinco exons. RT-PCR can RT-PCR pode be an alternative method in order to avoid analysis of individual ser um método alternativo para evitar a análise de cada um exons, but this requires adequately stored cells. exons, mas isso requer células armazenadas adequadamente. In the future, the assessment of the presence of the protein in No futuro, a avaliação da presença da proteína em muscle biopsies or in leukocytes by Western blot or immuno- biópsias do músculo ou em leucócitos por Western blot ou imuno- histochemistry (19) may become an alternative to mutation histoquímica (19) pode ser uma alternativa à mutação screening, if the level of expression is sufficient. triagem, se o nível de expressão é suficiente. Sixty five Sessenta e cinco percentofthemutationsarepredictedtotruncatetheprotein,thus percentofthemutationsarepredictedtotruncatetheprotein, assim probably leading to its degradation. provavelmente levando à sua degradação. Furthermore, some missense Além disso, alguns missense by on May 14, 2010 por em 14 de maio de 2010 http://hmg.oxfordjournals.org http://hmg.oxfordjournals.org Downloaded from Transferido de
--------------------------------------------------------------------------------
Page 6 Página 6
Human Molecular Genetics, 1997, Vol. Genética Molecular Humana, 1997, vol. 6, No. 9 6, n º 9 1510 1510 mutationsmayalsoleadtoselectivedegradationofmyotubularin mutationsmayalsoleadtoselectivedegradationofmyotubularin by affecting its stability or its appropriate targeting to subcellular afectando a sua estabilidade ou a sua adequada focalização para subcellular compartments. compartimentos. Functional implications As implicações funcionais The MTM1 gene is probably involved in a signal transduction O gene MTM1 provavelmente está envolvido em uma transdução de sinal pathway necessary for late myogenesis, although its ubiquitous caminho necessário para a miogênese tarde, embora a sua onipresente expression suggests a wider function. expressão sugere uma maior função. Almost all changes, Quase todas as alterações, insertion or deletion of amino acids, observed to date in patients inserção ou deleção de aminoácidos, observada a data em pacientes affect regions and residues that are conserved in the homologous afetam regiões e os resíduos que são conservados no homólogo yeast and C.elegans proteins, indicating their functional levedura e proteínas C.elegans, indicando a sua funcionais importance. importância. A tyrosine phosphatase active site is predicted in Um site tirosina fosfatase ativa está previsto no myotubularin. myotubularin. Although phosphatase activity has not yet been Embora a atividade da fosfatase ainda não foi demonstrated, two of the disease-causing mutations are demonstrado, duas das doenças que causam mutações são missenses within the PTP signature (amino acids 373–385) and missenses na assinatura PTP (aminoácidos 373-385) e eight involve neighbouring amino acids (encoded in exons envolvem oito vizinhos aminoácidos (codificado em exons 11 and 12) that may belong to the broader PTP domain which 11 e 12) que podem pertencer ao domínio mais vasto que PTP usually encompasses ∼ 250 amino acids around the active site geralmente engloba ~ 250 aminoácidos em torno do sítio ativo (20). (20). The A(1314–10)G intronic mutation causes an insertion of O A (1314-1310) G mutação intronic provoca uma inserção de three amino acids (420insFIQ) in a very conserved region close três aminoácidos (420insFIQ) em uma região muito conservada fechar to the PTP site, where we also found the R421Q missense. ao site PTP, onde também encontrou o missense R421Q. Weobservedtwootherpreferentialregionsformissenses.Four Weobservedtwootherpreferentialregionsformissenses.Four missense mutations were found in exons 8 and 9, corresponding mutações missense foram encontrados em exons 8 e 9, correspondente toaregionconservedthroughoutevolution(13). toaregionconservedthroughoutevolution (13). The other region A outra região corresponds to exons 4 and 5, but here the conservation in the corresponde a exons 4 e 5, mas aqui a conservação da yeast or C.elegans homologous genes is low. levedura ou C.elegans genes homólogos é baixa. These two domains Estes dois domínios of the protein may be involved in substrate recognition, da proteína pode estar envolvida no reconhecimento do substrato, appropriatetargetingtocellularcompartmentsorinteractionwith appropriatetargetingtocellularcompartmentsorinteractionwith other proteins. outras proteínas. The missense mutations we observed will be As mutações missense observamos será useful when studying putative functions or protein interactions of útil quando se estuda as funções putativas ou interações de proteínas myotubularin. myotubularin. Although no missense mutations were found in Apesar de nenhuma mutação missense foram encontrados em exons 14 and 15, the recurring R474X nonsense mutation exons 14 e 15, a mutação R474X absurdo recorrentes truncates this part of the protein, indicating that the C-terminal trunca essa parte da proteína, indicando que o C-terminal domain is important for the structure/stability of myotubularin. domínio é importante para a estrutura / estabilidade do myotubularin. Milder autosomal forms of CNM have been described (4). autosomal formas mais leves da CNM foram descritos (4). Candidate genes for such forms are the MTM-related genes, and genes candidatos para tais formas são as relacionadas com genes MTM, e genescodingforputativeproteinsthatinteractwithmyotubularin genescodingforputativeproteinsthatinteractwithmyotubularin or belong to the same signal transduction pathway. ou pertencem à mesma via de transdução de sinal. Identification Identificação ofgenesimplicatedinautosomalCNMmaythusshedlightonthe ofgenesimplicatedinautosomalCNMmaythusshedlightonthe function of myotubularin. função de myotubularin. Genotype–phenotype correlations Genótipo-fenótipo Given the ubiquitous expression of the gene and the existence of Dada a expressão ubíquo do gene e à existência de awell-conservedgeneinyeast,itissurprisingthatnotissuesother -Conservedgeneinyeast awell, itissurprisingthatnotissuesother than muscle have been clearly found to be affected in XLMTM do músculo foram claramente encontrado para ser afetado em XLMTM patients (21). pacientes (21). Other associated phenotypes might have been Outros fenótipos associados poderiam ter sido missed, as most patients die very early. não atendidas, como a maioria dos pacientes morrem muito cedo. Alternatively, Como alternativa, tissue-specific pathology could result from interaction with Patologia específica dos tecidos pode resultar da interacção com muscle-specific proteins, or from a different balance of proteins Específicos de proteínas musculares, ou de um equilíbrio diferente de proteínas with overlapping functions encoded by the MTM-related genes. com sobreposição de funções codificadas por genes relacionados com o MTM. Additional clinical features were only described for patients Outras características clínicas só foram descritos em pacientes with large deletions, and suggest a contiguous gene syndrome com grandes deleções, e sugerem uma síndrome contígua do gene (11). (11). A gene involved in male sexual development must be Um gene envolvido no desenvolvimento sexual masculino devem ser centromeric to MTM1 in the region deleted in G89-441 and centromérica de MTM1 na região suprimida G89-441 e G89-474, but present in CM73. G89-474, mas presente em CM73. The F18 gene and O gene F18 e XAP80 – XAP87 transcriptsrepresentcandidatesforsuchfunction XAP80 - XAP87 transcriptsrepresentcandidatesforsuchfunction (22,23). (22,23). From our data, there is no obvious correlation between the type A partir de nossos dados, não existe uma correlação evidente entre o tipo of mutation and the severity of the disease. de mutação e da gravidade da doença. Some patients with Alguns pacientes com nonsense or frameshift mutations have survived 7–14 years frameshift ou mutações nonsense ter sobrevivido 7-14 anos (mutations 451delAT, C718T and 890delC), while other patients (Mutações 451delAT, C718T e 890delC), enquanto outros pacientes with missense mutations died in the neonatal period. com mutações missense morreram no período neonatal. Moreover, Além disso, patient 4711 (451delAT) is still alive at 7 years but a brother died paciente 4711 (451delAT) ainda está vivo em 7 anos, mas um irmão morreu neonatally. neonatal. The missense R241C led to a mild phenotype in two O R241C missense levou a um fenótipo leve em dois cases [patient N2-9 in this study, and (24)], while a R241L casos de paciente [N2-9, neste estudo, e (24)], enquanto um R241L mutation caused a severe phenotype (28). mutação causou um fenótipo grave (28). Because of the Devido à existenceofsuchmilderphenotypes,itmaybeimportanttocheck existenceofsuchmilderphenotypes, itmaybeimportanttocheck for mutations in cases diagnosed as autosomal recessive de mutações em casos diagnosticados como autossômica recessiva centronuclear/myotubular myopathy if the autosomal inheritance myotubular / miopatia centronuclear se a herança autossômica is not well established. não está bem estabelecida. It is possible that in most cases survival depends more on É possível que na maioria dos casos, a sobrevivência depende mais clinical treatment and other parameters (prematurity, putative tratamento clínico e outros parâmetros (prematuridade, putativo modifyinggenes)thanonthenatureofthemutation.Ithasindeed modifyinggenes) thanonthenatureofthemutation.Ithasindeed been suggested that, once a patient survives beyond a certain sido sugerido que, uma vez que um paciente sobrevive além de um certo point, he may have improvement in his condition (4). ponto, ele pode ter melhoria na sua condição (4). We conclude that the MTM1 gene is indeed the principal and Nós concluímos que o gene MTM1 é realmente o principal e probably the only gene implicated in XLMTM. provavelmente apenas o gene implicado na XLMTM. Mutation Mutação detection has already proven to be very useful for genetic detecção já provou ser muito útil para genética counselling, carrier detection and prenatal diagnosis in families. aconselhamento, a detecção de portadora e diagnóstico pré-natal em família. MATERIALS AND METHODS MATERIAIS E MÉTODOS Identification of mutations Identificação de mutações Genomic DNA was prepared from cultured fibroblasts, cultured O DNA genômico foi preparado a partir de cultura de fibroblastos, cultivadas lymphoblastoid cell lines or venous EDTA blood (25). lymphoblastoid linhas de células de sangue EDTA ou venosa (25). Primer Cartilha sets were designed from intronic and exonic sequences flanking conjuntos foram concebidos a partir de seqüências intrônicas e exonic acompanhamento the 15 exons of the MTM1 gene. os 15 exons do gene MTM1. Primer sequences and PCR seqüências dos iniciadores e PCR conditions are summarized in Table 1. condições estão resumidos na tabela 1. Briefly, 100 ng of patient Resumidamente, 100 ng de paciente DNA were amplified in 10 mM Tris–HCl pH 8.3, 50 mM KCl, DNA foram amplificadas em 10 mM Tris-HCl pH 8,3, 50 mM KCl, 200 µ M dNTP, the defined MgCl 200 μ M dNTP, o MgCl definido 2 2 concentrations, with 10 pmol concentrações, com 10 pmol of each primers, 1 nmol (3 µ Ci) of [ de cada primers, 1 nmol (3 μ Ci) de [ 32 32 P]dCTP and 1 U of Taq P] dCTP e 1 U de Taq polymeraseinatotalvolumeof25 µ l.Thermocyclingwascarried polymeraseinatotalvolumeof25 μ l.Thermocyclingwascarried out in the PTC-100 Programmable Thermal Controller no PTC-100 Thermal Controlador Programável (MJ Research, Inc.) at 94_C for 5 min followed by 30 cycles at (MJ Research, Inc.) com 94_C por 5 min seguido por 30 ciclos em 94_C for 10 s, annealing temperature for 10 s, 72_C for 10 s, and 94_C para 10 s, temperatura de tratamento térmico por 10 s, 72_C para 10 s, e afinalelongationstepat72_Cfor5min.Forexon1,thePCRwas afinalelongationstepat72_Cfor5min.Forexon1, thePCRwas performed with 3 min elongation at each cycle and with 10% realizada com 3 min de alongamento a cada ciclo, com 10% dimethylsulfoxide (DMSO) and 3.75 nmol of C7deaza guanine; dimetilsulfóxido (DMSO) e 3,75 nmol de guanina C7deaza; thentheproductwasdigestedby Sal Iintotwofragments(176and thentheproductwasdigestedby Sal Iintotwofragments (176and 279 nucleotides). 279 nucleotídeos). After PCR, the products were denaturated at 94_C for 10 min Após a PCR, os produtos foram desnaturadas a 94_C por 10 min with 6 µ l of SSCP loading buffer (0.2 M NaOH, 0.25% w/v each com 6 μ l de tampão de carregamento SSCP (NaOH 0,2 M, 0,25% w / v cada bromophenol blue and xylene cyanol in formamide) and azul de bromofenol e xileno cianol em formamida) e separatedona6%nativepolyacrylamidegel.Foreachprimerset, separatedona6 nativepolyacrylamidegel.Foreachprimerset%, gels were run at 4_C under two conditions: overnight at 6 W and géis foram executados em 4_C sob duas condições: uma noite de 6 W e 5 h at 30 W. Shifted bands were excised from the gel and 5 h em 30 Shifted W. bandas excisadas do gel e reamplified in 200 µ l, then purified using the Geneclean Kit reamplified em 200 μ l, em seguida, purificados utilizando o Kit Geneclean (Bio 101, Inc.) and sequenced on an Applied Biosystems (ABI) (Bio 101, Inc.) e seqüenciado em um Applied Biosystems (ABI) automated sequencer with fluorescent dideoxynucleotides using seqüenciador automático com Didesoxinucleotídeos fluorescente usando the same primers as for PCR. os mesmos primers que para PCR. For patients identified as CNMx, the same PCR amplification Para os pacientes identificados como CNMX, a amplificação mesmo was carried out in a Thermal Cycler 2400 (Perkin Elmer). foi realizada em um termociclador 2400 (Perkin Elmer). Initial Inicial denaturation was at 95_C for 2 min, followed by 28 cycles of desnaturação foi de 95_C por 2 min, seguido de 28 ciclos de 95_C for 15 s, annealing for 15 s (at 52_C: exons 5, 10, 12, 13, 95_C durante 15 s, anelamento por 15 s (em 52_C: exons 5, 10, 12, 13, 14; at 56_C: exons 3, 4, 6, 8, 9, 11, 15), and 72_C for 45 s. 14, em 56_C: exons 3, 4, 6, 8, 9, 11, 15), e 72_C por 45 s. Final Final extension was at 72_C for 7 min. prorrogação foi em 72_C por 7 min. PCR products were analysed Os produtos da PCR foram analisados after denaturation on 12% acrylamide gels containing 7.25% após desnaturação em gel de acrilamida 12%, contendo 7,25% glycerol using a two-buffer system (Liechti-Gallati et al ., glicerol usando um sistema de buffer (dois Liechti-Gallati et al. submitted). apresentados). DNA was visualized by silver staining (26). O DNA foi visualizado por coloração pela prata (26). Sequencechangesweredetectedeitherby doubleor singlestrand Sequencechangesweredetectedeitherby singlestrand doubleor band shifts or by the generation of heteroduplex on the same gel. mudanças banda ou pela geração de heteroduplex no mesmo gel. by on May 14, 2010 por em 14 de maio de 2010 http://hmg.oxfordjournals.org http://hmg.oxfordjournals.org Downloaded from Transferido de
--------------------------------------------------------------------------------
Page 7 Página 7
1511 1511 Nucleic Acids Research, 1994, Vol. Nucleic Acids Research, 1994, vol. 22, No. 1 22, No. 1 Human Molecular Genetics, 1997, Vol. Genética Molecular Humana, 1997, vol. 6, No. 9 1511 6, n º 9 1511 SSCP variants were purified directly using QIAquick PCR variantes SSCP foram purificadas diretamente usando QIAquick PCR purification columns (QIAGEN) according to the supplier and colunas de purificação (QIAGEN), de acordo com o fornecedor e sequenced. seqüenciados. Large deletions were confirmed by PCR amplification of the grandes deleções foram confirmados por PCR do different exons using the primers in Table 1, and by Southern blot exons diferentes, utilizando os primers na Tabela 1, e pela Southern blot from patient genomic DNA (11) digested with Bst YIor Msp I and a partir de DNA genômico do paciente (11) digerido com Bst YIor Msp I e hybridized with exon-specific PCR products. hibridizado com produtos específicos de PCR-exon. Microsatellite genotyping Genotipagem de microssatélites In order to confirm that patients with recurrent mutations were A fim de confirmar que os pacientes com mutações recorrentes foram from different families, they were all genotyped using de famílias diferentes, todos eles foram genotipadas utilizando polymorphic markers DXS8377 and DXS7423 closely flanking marcadores polimórficos DXS8377 e DXS7423 acompanhamento de perto the MTM1 gene (17). o gene MTM1 (17). ACKNOWLEDGEMENTS AGRADECIMENTOS We wish to thank Christine Kretz, Serge Vicaire and Vreni Queremos agradecer a Christine Kretz, Serge Vicaire e Vreni Schneider for excellent technical assistance in SSCP analysis and Schneider para a assistência técnica excelente na análise de SSCP e the sequencing work. o trabalho de seqüenciamento. We would also like to thank all clinicians Gostaríamos também de agradecer a todos os clínicos listed in Table 2 and the Genethon for tissues and blood samples listadas na Tabela 2 e os Généthon de tecidos e amostras de sangue of XLMTM families. das famílias XLMTM. Collaboration within the ENMC Colaboração na ENMC International MTM Consortium was sponsored by the EAMDA International Consortium MTM foi patrocinado pela EAMDA and the European Neuro-Muscular Center (Baarn, The eo Centro Neuro-Muscular Europeia (Baarn, O Netherlands). Países Baixos). This study was supported by the Institut National Este estudo foi financiado pelo Instituto Nacional de la Santé et de la Recherche Médicale, the Centre National de de la Santé et de la Recherche Médicale, o Centro Nacional de la Recherche Scientifique, the Centre Hopitalier Universitaire la Recherche Scientifique, o Centro Universitário Hopitalier Régional,andbygrantsfromtheAssociationFrançaisecontreles Régional, andbygrantsfromtheAssociationFrançaisecontreles Myopathies (AFM), the Swiss National Research Foundation Miopatias (AFM), a Fundação de Pesquisa Nacional da Suíça (No. 32-043631.95) and Ronald McDonalds fund. (N. º 32-043.631,95) e Ronald McDonalds fundo. REFERENCES REFERÊNCIAS 1. 1. Sarnat, HB (1990) Myotubular myopathy: arrest of morphogenesis of Sarnat, HB (1990) miopatia myotubular: detenção de morfogênese do myofibres associated with persistence of fetal vimentin and desmin. myofibras associados com a persistência de vimentina e desmina fetal. Four Quatro cases compared with fetal and neonatal muscle. Can. casos em comparação com o músculo fetal e neonatal. Can. J. Neurol. J. Neurol. Sci. , 17 , Sci., 17, 109–123. 109-123. 2. 2. Spiro, AJ, Shy, GM and Gonatas, NK (1966) Myotubular myopathy, Spiro, AJ, Shy, GM e Gonatas, NK (1966) myotubular miopatia, persistence of fetal muscle in an adolescent boy. Arch. persistência do músculo fetal em um menino adolescente. Arch. Neurol. , 14 , 1–14. Neurol., 14, 1-14. 3. 3. Wallgren-Pettersson, C. and Thomas, NS (1994) Report on the 20th ENMC Wållgren Pettersson, e C. Thomas, NS 1994) Report (no ENMC 20 sponsored international workshop: myotubular/centronuclear myopathy. workshop internacional patrocinada: centronuclear / miopatia myotubular. Neuromuscul. Neuromuscul. Disord. , 4 , 71–74. Disord., 4, 71-74. 4. 4. Wallgren-Pettersson, C., Clarke, A., Samson, F., Fardeau, M., Dubowitz, V., Wållgren Pettersson, C. Clarke, A., Samson, F., Fardeau, M., Dubowitz, V., Moser, H., Grimm, T., Barohn, RJ and Barth, PG (1995) The myotubular Moser, H., Grimm, T., Barohn, RJ e Barth, PG (1995) O myotubular myopathies: differential diagnosis of the X linked recessive, autosomal miopatias: diagnóstico diferencial das recessiva ligada ao X, autossômico dominant, and autosomal recessive forms and present state of DNA studies. E autossômica recessiva formas dominantes e estado actual dos estudos de DNA. J. Med. J. Med. Genet. , 32 , 673–679. Genet., 32, 673-679. 5. 5. Thomas, N. and Wallgren-Pettersson, C. (1996) X-linked myotubular Thomas, N. e Wållgren-Pettersson, C. (1996), X-linked myotubular myopathy. miopatia. 33rd ENMC International Workshop Soest. 33 Workshop Internacional ENMC Soest. The Netherlands, Os Países Baixos, 9–11 June 1995. Neuromuscul. 09-11 junho de 1995. Neuromuscul. Disord. , 6 , 129–132. Disord., 6, 129-132. 6. 6. Thomas,NS,Williams,H.,Cole,G.,Roberts,K.,Clarke,A.,Liechti-Gallati, Thomas, NS, Williams, H., Coelho, G., Roberts, K., Clarke, A., Liechti-Gallati, S., Braga, S., Gerber, A., Meier, C., Moser, H. et al . S., Braga, S., Gerber, A., Meier, C., Moser, H. et al. (1990) X linked neonatal (1990) ligado ao X neonatal centronuclear/myotubular myopathy: evidence for linkage to Xq28 DNA miopatia myotubular: / provas de ligação a DNA Xq28 centronuclear marker loci. J. locos marcadores. J. Med. Med. Genet. , 27 , 284–287. Genet., 27, 284-287. 7. 7. Liechti-Gallati, S., Muller, B., Grimm, T., Kress, W., Muller, C., Boltshauser, Liechti-Gallati, S., Muller, B., Grimm, T., Kress, W., Muller, C., Boltshauser, E., Moser, H. and Braga, S. (1991) X-linked centronuclear myopathy: E., Moser, H. e Braga, S. (1991), X-linked miopatia centronuclear: mapping the gene to Xq28. Neuromuscul. mapeamento do gene Xq28. Neuromuscul. Disord. , 1 , 239–245. Disord., 1, 239-245. 8. 8. Dahl,N.,Samson,F.,Thomas,NS,Hu,LJ,Gong,W.,Herman,G.,Laporte, Dahl, N., Samson, F., Thomas, NS, Hu, LJ, Gong, W., Herman, G., Laporte, J., Kioschis, P., Poustka, A. and Mandel, JL (1994) X linked myotubular J., Kioschis, P., Poustka, A. e Mandel, JL (1994) ligado ao X myotubular myopathy (MTM1) maps between DXS304 and DXS305, closely linked to miopatia (MTM1) entre DXS304 mapas e DXS305, estreitamente ligada à the DXS455 VNTR and a new, highly informative microsatellite marker o VNTR DXS455 e um novo marcador microssatélite altamente informativo (DXS1684). J. (DXS1684). J. Med. Med. Genet. , 31 , 922–924. Genet., 31, 922-924. 9. 9. Dahl, N., Hu, LJ, Chery, M., Fardeau, M., Gilgenkrantz, S., Nivelon- Dahl, N., Hu, LJ, Chery, M., Fardeau, M., Gilgenkrantz, S., Nivelon- Chevallier, A., Sidaner-Noisette, I., Mugneret, F., Gouyon, JB, Gal, A. et al . Chevallier, A.,-Noisette Sidaner, I., Mugneret, F., Gouyon, JB, Gal, A. et al. (1995) Myotubular myopathy in a girl with a deletion at Xq27–q28 and (1995) miopatia myotubular em uma menina com uma deleção Xq27-q28 em e unbalanced X inactivation assigns the MTM1 gene to a 600-kb region. inativação do X desequilibrado atribui o gene MTM1 a uma região de 600 kb. Am. Am. J. Hum. J. Hum. Genet. , 56 , 1108–1115. Genet., 56, 1108-1115. 10. 10. Hu, LJ, Laporte, J., Kioschis, P., Heyberger, S., Kretz, C., Poustka, A., Hu, LJ, Laporte, J., Kioschis, P., Heyberger, S., Kretz, C., Poustka, A., Mandel, JL and Dahl, N. (1996) X-linked myotubular myopathy: Mandel, JL e Dahl, N. (1996), X-linked miopatia myotubular: refinement of the gene to a 280-kb region with new and highly informative refinamento do gene para uma região de 280 kb com a nova e altamente informativa microsatellite markers. Hum. marcadores microssatélites. Hum. Genet. , 98 , 178–181. Genet., 98, 178-181. 11. 11. Hu, LJ, Laporte, J., Kress, W., Kioschis, P., Siebenhaar, R., Poustka, A., Hu, LJ, Laporte, J., Kress, W., Kioschis, P., Siebenhaar, R., Poustka, A., Fardeau, M., Metzenberg, A., Janssen, EA, Thomas, N., Mandel, JL and Dahl, N. (1996) Deletions in Xq28 in two boys with myotubular myopathy and abnormal genital development define a new contiguous gene syndrome in a 430 kb region. Hum. Mol. Mol. Genet. , 5 , 139–143. 12. 12. Smolenicka, Z., Laporte, J., Hu, LJ, Dahl, N., Fitzpatrick, J., Kress, W. and Liechti-Gallati, S. (1996) X-linked myotubular myopathy: refinement of the critical gene region. Neuromuscul. Disord. , 6 , 275–281. 13. 13. Laporte, J., Hu, LJ, Kretz, C., Mandel, JL, Kioschis, P., Coy, JF, Klauck, SM, Poustka, A. and Dahl, N. (1996) A gene mutated in X-linked myotubular myopathy defines a new putative tyrosine phosphatase family conserved in yeast. Nature Genet. , 13 , 175–182. 14. 14. Tanner, SM, Laporte, J., Guiraud-Chaumeil, C. and Liechti-Gallati, S. (1997) Confirmation of prenatal diagnosis results of X-linked recessive myotubular myopathy by mutational screening, and description of three new mutations in the MTM1 gene. Hum. Mutat. , in press. 15. 15. Guiraud-Chaumeil, C., Vincent, MC, Laporte, J., Fardeau, M., Samson, F. andMandel,JL(1997)AmutationintheMTM1geneinvalidatesaprevious suggestion of non allelic heterogeneity in X-linked myotubular myopathy. Am. Am. J. Hum. Genet. , in press. 16. 16. Vincent,M.-C., Guiraud-Chaumeil, C.,Laporte, J.,Manouvrier-Hanu, S. and Mandel, J.-L. (1997) Extensive germinal mosaicism in a family with X-linked myotubular myopathy simulates genetic heterogeneity. J. Med. J. Med. Genet. , in press. 17. 17. Hu, LJ, Laporte, J., Kress, W. and Dahl, N. (1996) Prenatal diagnosis of X-linkedmyotubularmyopathy:strategiesusingnewandtightlylinkedDNA markers. Prenat. Diagn. , 16 , 231–237. 18. 18. Samson, F., Mesnard, L., Heimburger, M., Hanauer, A., Chevallay, M., Mercadier, JJ, Pelissier, JF, Feingold, N., Junien, C., Mandel, JL et al . (1995) Genetic linkage heterogeneity in myotubular myopathy. Am. Am. J. Hum. Genet. , 57 , 120–126. 19. 19. Willemsen,R., Mohkamsing, S., De Vries, B.,Devys, D., van den Ouweland, A., Mandel, JL, Galjaard, H. and Oostra, B. (1997) Rapid antibody test for fragile X syndrome. Lancet , 345 , 1147–1148. 20. 20. Fauman, E. and Saper, MA (1996) Structure and function of the protein tyrosine phosphatases. Trends Biochem. Sci. , 21 , 413–417. 21. 21. Joseph, M., Pai, GS, Holden, KR and Herman, G. (1995) X-linked myotubular myopathy: clinical observations in ten additional cases. Am. Am. J. Med. J. Med. Genet. , 59 , 168–173. 22. 22. Kioschis, P., Rogner, UC, Pick, E., Klauck, SM, Heiss, N., Siebenhaar, R., Korn, B., Coy, JF, Laporte, J., Liechti-Gallati, S. and Poustka, A. (1996) A 900-kb cosmid contig and 10 new transcripts within the candidate region for myotubular myopathy (MTM1). Genomics , 33 , 365–373. 23. 23. Laporte, J., Kioschis, P., Hu, LJ, Kretz, C., Carlsson, B., Poustka, A., Mandel, JL and Dahl, N. (1997) Cloning and characterization of an alternative spliced gene in proximal Xq28 deleted in two patients with intersexual genitalia and myotubular myopathy. Genomics , 41 , 458–462. 24. 24. Donelly, A., Haan, E., Manson, J. and Mulley, J. (1997) A novel mutation in exon b (R259C) of the MTM1 gene is associated with myotubular myopathy. Hum. Hum. Mutat. , in press. 25. 25. Miller, S., Dykes, D. and Polesky, H. (1988) A simple salting out method for extracting DNA from human nucleated cells. Nucleic Acids Res. , 16 , 1215. 26. 26. Budowle, B., Chakraborty, R., Giusti, AM, Eisenberg, AJ and Allen, RC (1991) Analysis of the VNTR locus D1S80 by the PCR followed by high-resolution PAGE. Am. J. Hum. Genet. , 48 , 137–144. 27. 27. Ad Hoc Committee on Mutation Nomenclature (1996) Update on nomenclature for human gene mutations. Hum. Mutat. , 8 , 197–202. 28. 28. de Gouyon, BM, Zhao, W., Laporte, J., Mandel, J.-L., Metzenberg, A. and Herman, GE (1997) Characterization of mutations in the recently identified myotubularin gene in 26 patients with X-linked myotubular myopathy. Hum. Hum. Mol. Mol. Genet . 6 , 1499–1504. by on May 14, 2010 por em 14 de maio de 2010 http://hmg.oxfordjournals.org Downloaded from Transferido de
Assinar:
Postagens (Atom)